John L. McClellan Memorial Veterans Hospital
Hospital / health systemLittle Rock, Arkansas, United States
Research output, citation impact, and the most-cited recent papers from John L. McClellan Memorial Veterans Hospital (United States). Aggregated across the NobleBlocks index of 300M+ scholarly works.
Top-cited papers from John L. McClellan Memorial Veterans Hospital
OBJECTIVE: To determine whether there is a link between hypoglycaemia and mortality among participants in the Action to Control Cardiovascular Risk in Diabetes (ACCORD) trial. DESIGN: Retrospective epidemiological analysis of data from the ACCORD trial. Setting Diabetes clinics, research clinics, and primary care clinics. PARTICIPANTS: Patients were eligible for the ACCORD study if they had type 2 diabetes, a glycated haemoglobin (haemoglobin A(1C)) concentration of 7.5% or more during screening, and were aged 40-79 years with established cardiovascular disease or 55-79 years with evidence of subclinical disease or two additional cardiovascular risk factors. Intervention Intensive (haemoglobin A(1C) <6.0%) or standard (haemoglobin A(1C) 7.0-7.9%) glucose control. OUTCOME MEASURES: Symptomatic, severe hypoglycaemia, manifest as either blood glucose concentration of less than 2.8 mmol/l (<50 mg/dl) or symptoms that resolved with treatment and that required either the assistance of another person or medical assistance, and all cause and cause specific mortality, including a specific assessment for involvement of hypoglycaemia. RESULTS: 10 194 of the 10 251 participants enrolled in the ACCORD study who had at least one assessment for hypoglycaemia during regular follow-up for vital status were included in this analysis. Unadjusted annual mortality among patients in the intensive glucose control arm was 2.8% in those who had one or more episodes of hypoglycaemia requiring any assistance compared with 1.2% for those with no episodes (53 deaths per 1924 person years and 201 deaths per 16 315 person years, respectively; adjusted hazard ratio (HR) 1.41, 95% CI 1.03 to 1.93). A similar pattern was seen among participants in the standard glucose control arm (3.7% (21 deaths per 564 person years) v 1.0% (176 deaths per 17 297 person years); adjusted HR 2.30, 95% CI 1.46 to 3.65). On the other hand, among participants with at least one hypoglycaemic episode requiring any assistance, a non-significantly lower risk of death was seen in those in the intensive arm compared with those in the standard arm (adjusted HR 0.74, 95% 0.46 to 1.23). A significantly lower risk was observed in the intensive arm compared with the standard arm in participants who had experienced at least one hypoglycaemic episode requiring medical assistance (adjusted HR 0.55, 95% CI 0.31 to 0.99). Of the 451 deaths that occurred in ACCORD up to the time when the intensive treatment arm was closed, one death was adjudicated as definitely related to hypoglycaemia. CONCLUSION: Symptomatic, severe hypoglycaemia was associated with an increased risk of death within each study arm. However, among participants who experienced at least one episode of hypoglycaemia, the risk of death was lower in such participants in the intensive arm than in the standard arm. Symptomatic, severe hypoglycaemia does not appear to account for the difference in mortality between the two study arms up to the time when the ACCORD intensive glycaemia arm was discontinued. TRIAL REGISTRATION: NCT00000620.
A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.
Polymorphonuclear leukocytes from patients with chronic granulomatous disease respond to the phagocytosis of latex particles with normal increments in glucose consumption, lactate production, Krebs' cycle activity, and lipid turnover. The leukocytes of these patients fail to show normal increments in respiration, direct oxidation of glucose, and hydrogen peroxide formation during particle uptake. It appears that the stimulation of respiration with the formation of hydrogen peroxide and stimulation of the direct oxidative pathway of glucose metabolism are closely linked to degranulation and intracellular killing of bacteria by polymorphonuclear leukocytes.
OBJECTIVE: To systematically review trends in the epidemiology of the first attack of acute pancreatitis (AP) based on reported population-based studies. METHODS: From Medline, we retrieved 18 full-length English language peer-reviewed original articles published from 1966 to June 2005 with population-based information on the epidemiology of first-attack AP. Trends over time were analyzed based on study- and country-specific data and the study site (UK vs non-UK). RESULTS: Eight studies were from the UK and 10 from other European centers. An increase in the annual incidence per 100,000 for first-attack AP was reported in 10 of 12 studies with longitudinal data from 4 countries (UK, Sweden, Denmark, and Netherlands). The overall AP incidence seems to be higher in non-UK studies compared with that of UK, partly explained by a higher incidence of alcoholic pancreatitis in non-UK studies. A linear trend for increase in gallstone pancreatitis incidence over time was observed irrespective of the study site (UK or non-UK). The AP incidence and mortality increased with age. Gallstone pancreatitis was more common in female subjects, and alcoholic pancreatitis was more common in middle-aged male subjects. The AP case fatality (%) has decreased over time, but the overall population mortality rate per 100,000 has remained unchanged. Recurrence after the first attack is milder with a substantially lower mortality. CONCLUSIONS: The incidence of AP seems to be increasing. Differences in the incidence and etiology between and within countries reflect differences in the risk factor prevalence. Case-fatality rate, but not the population-based mortality rate, decreased over time.
Human diploid fibroblasts undergo replicative senescence predominantly because of arrest at the G1/S boundary of the cell cycle. Senescent arrest resembles a process of terminal differentiation that appears to involve repression of proliferation-promoting genes with reciprocal new expression of antiproliferative genes, although post-transcriptional factors may also be involved. Identification of participating genes and clarification of their mechanisms of action will help to elucidate the universal cellular decline of biological aging and an important obverse manifestation, the rare escape of cells from senescence leading to immortalization and oncogenesis.
Regional recurrence of malignant tumors in the peritoneal cavity usually signifies a poor prognosis for the host and often results in gastrointestinal complications requiring surgical intervention. One hundred patients with nongynecological malignancies found with peritoneal carcinomatosis were followed prospectively. The most common primary tumors were colorectal (N = 45) and pancreatic (N = 20) carcinoma. When associated with pancreatic carcinoma, 65% of patients had liver metastases and 60% had ascites. The presence of ascites was associated with poor survival, with no patient surviving past 30 days. Ascites was also a sign of poor prognosis in patients with colorectal carcinoma. Among possible prognostic factors in colorectal carcinoma patients, only disease-free interval, presence of lung metastases, and ascites showed statistically significant correlations with survival. Peritoneal carcinomatosis in sarcoma (N = 7) and breast cancer (N = 6) patients had median survival of 12 and 7 months, respectively. Surgical intervention for gastrointestinal complications in peritoneal carcinomatosis can provide significant palliation, with a few exceptions such as in patients with pancreatic or gastric carcinoma, ascites, and poor performance status.
BACKGROUND AND PURPOSE: Frequency and duration of static stretching have not been extensively examined. Additionally, the effect of multiple stretches per day has not been evaluated. The purpose of this study was to determine the optimal time and frequency of static stretching to increase flexibility of the hamstring muscles, as measured by knee extension range of motion (ROM). SUBJECTS: Ninety-three subjects (61 men, 32 women) ranging in age from 21 to 39 years and who had limited hamstring muscle flexibility were randomly assigned to one of five groups. The four stretching groups stretched 5 days per week for 6 weeks. The fifth group, which served as a control, did not stretch. METHODS: Data were analyzed with a 5 x 2 (group x test) two-way analysis of variance for repeated measures on one variable (test). RESULTS: The change in flexibility appeared to be dependent on the duration and frequency of stretching. Further statistical analysis of the data indicated that the groups that stretched had more ROM than did the control group, but no differences were found among the stretching groups. CONCLUSION AND DISCUSSION: The results of this study suggest that a 30-second duration is an effective amount of time to sustain a hamstring muscle stretch in order to increase ROM. No increase in flexibility occurred when the duration of stretching was increased from 30 to 60 seconds or when the frequency of stretching was increased from one to three times per day.
Cells of the bone marrow stroma can reversibly convert among different phenotypes. Based on this and on evidence for a reciprocal relationship between osteoblastogenesis and adipogenesis, we have isolated several murine bone marrow-derived clonal cell lines with phenotypic characteristics of osteoblasts or adipocytes, or both. Consistent with a state of plasticity, cell lines with a mixed phenotype synthesized osteoblast markers like type I collagen, alkaline phosphatase, osteocalcin, as well as the adipocyte marker lipoprotein lipase, under basal conditions. In the presence of ascorbic acid and beta-glycerophosphate-agents that promote osteoblast differentiation-they formed a mineralized matrix. In the presence of isobutylmethylxanthine, hydrocortisone, and indomethacin-agents that promote adipocyte differentiation-they accumulated fat droplets, but failed to express adipsin and aP2, markers of terminally differentiated adipocytes. Furthermore, they were converted back to matrix mineralizing cells when the adipogenic stimuli were replaced with the osteoblastogenic ones. A prototypic cell line with mixed phenotype (UAMS-33) expressed Osf2/Cbfa1-a transcription factor required for osteoblast differentiation, but not PPARgamma2-a transcription factor required for terminal adipocyte differentiation. Stable transfection with a PPARgamma2 expression construct and activation with the thiazolidinedione BRL49653 stimulated aP2 and adipsin synthesis and fat accumulation, and simultaneously suppressed Osf2/Cbfa1, alpha1(I) procollagen, and osteocalcin synthesis. Moreover, it rendered the cells incapable of forming a mineralized matrix. These results strongly suggest that PPARgamma2 negatively regulates stromal cell plasticity by suppressing Osf2/Cbfa1 and osteoblast-like biosynthetic activity, while promoting terminal differentiation to adipocytes.
Glutathione S-transferase P1-1 isoforms, differing in a single amino acid residue (Ile104 or Val104), have been previously identified in human placenta [Ahmad, H., Wilson, D. E., Fritz, R. R., Singh, S. V., Medh, R. D., Nagle, G. T., Awasthi, Y. C. & Kurosky, A. (1990) Arch. Biochem. Biophys. 278, 398-408]. In the present report, the enzymic properties of these two proteins are compared. [I104]glutathione S-transferase P1-1 has been expressed from its cDNA in Escherichia coli and purified to homogeneity by affinity chromatography; the cDNA has been mutated to replace Ile104 by Val104, and [V104]glutathione S-transferase P1-1 was expressed and isolated as described for [I104]glutathione S-transferase P1-1. The two enzymes differed in their specific activity and affinity for electrophilic substrates (KM values for 1-chloro-2,4-dinitrobenzene were 0.8 mM and 3.0 mM for [I-104]glutathione S-transferase P1-1 and [V-104]glutathione S-transferase P1-1, respectively), but were identical in their affinity for glutathione. In addition, the two enzymes were distinguishable by their heat stability, with half-lives at 45 degrees C of 19 min and 51 min, respectively. The resistance to heat denaturation was differentially modulated by the presence of substrates. These data, in conjunction with molecular modeling, indicate that the residue in position 104 helps to define the geometry of the hydrophobic substrate-binding site, and may also influence activity by interacting with residues directly involved in substrate binding.
Each of the myogenic helix-loop-helix transcription factors (MyoD, Myogenin, Myf-5, and MRF4) is capable of activating muscle-specific gene expression, yet distinct functions have not been ascribed to the individual proteins. We report here that MyoD and Myogenin mRNAs selectively accumulate in hindlimb muscles of the adult rat that differ in contractile properties: MyoD is prevalent in fast twitch and Myogenin in slow twitch muscles. The distribution of MyoD and Myogenin transcripts also differ within a single muscle and correlate with the proportions of fast glycolytic and slow oxidative muscle fibres, respectively. Furthermore, the expression of a transgene consisting of a muscle-specific cis-regulatory region from the myoD gene controlling lacZ was primarily associated with the fast glycolytic fibres. Alteration of the fast/slow fibre type distribution by thyroid hormone treatment or by cross-reinnervation resulted in a corresponding alteration in the MyoD/Myogenin mRNA expression pattern. These findings show that the expression of specific myogenic helix-loop-helix regulators is under the control of innervation and humoral factors and may mediate differential control of contractile protein gene expression in adult muscle.
The wide variations in urinary bladder and colo-rectal cancer incidence in humans have been attributed in part to metabolic factors associated with exposure to carcinogenic aromatic and heterocyclic amines. Cytochrome P-4501A2 (CYP1A2), which catalyses N-oxidation, and acetyltransferase (NAT2) which catalyses N- and O-acetylation, both appear to be polymorphically distributed in human populations; and slow and rapid NAT2 phenotypes have been implicated as risk factors for these cancers. Caffeine has also been shown to undergo 3-demethylation by CYP1A2, and it is further acetylated to 5-acetylamino-6-formylamino-3-methyluracil (AFMU) by the polymorphic NAT2. In this report, we describe a metabolic phenotyping procedure that can be used to determine concomitantly the hepatic CYP1A2 and NAT2 phenotypes. For the NAT2 phenotype, we confirm the valid use of the urinary molar ratio of AFMU/1-methylxanthine, even in alkaline urines. For the CYP1A2 phenotype, the urinary molar ratio of [1,7-dimethylxanthine + 1,7-dimethyluric acid]/caffeine, taken at 4-5 h after caffeine ingestion, was identified from pharmacokinetic analyses of 12 subjects as being better correlated (r = 0.73; p = 0.007) with the rate constant for caffeine 3-demethylation than other previously suggested ratios. This procedure was then used to determine the CYP1A2 phenotype in subjects from Arkansas (n = 101), Italy (n = 95), and China (n = 78). Statistical and probit analyses of nonsmokers indicated that the CYP1A2 activity was not normally distributed and appeared trimodal. This trimodality allowed arbitrary designation of slow, intermediate, and rapid phenotypes, which ranged from 12-13% slow, 51-67% intermediate, and 20-37% rapid, in the different populations. A reproducibility study of 13 subjects over a 5 day or 5 week period showed that, with one exception, intraindividual variability did not alter this CYP1A2 phenotypic classification. Induction of CYP1A2 by cigarette smoking was also confirmed by the increased caffeine metabolite ratios observed in the Arkansas and Italian smokers (blonde tobacco). However, Italian smokers of black tobacco and Chinese smokers did not appear to be induced. Furthermore, probit analyses of Arkansas and Italian blonde tobacco smokers could not discriminate between phenotypes, apparently as a consequence of enzyme induction.
Cells of the bone marrow stroma can reversibly convert among different phenotypes. Based on this and on evidence for a reciprocal relationship between osteoblastogenesis and adipogenesis, we have isolated several murine bone marrow-derived clonal cell lines with phenotypic characteristics of osteoblasts or adipocytes, or both. Consistent with a state of plasticity, cell lines with a mixed phenotype synthesized osteoblast markers like type I collagen, alkaline phosphatase, osteocalcin, as well as the adipocyte marker lipoprotein lipase, under basal conditions. In the presence of ascorbic acid and β-glycerophosphate—agents that promote osteoblast differentiation—they formed a mineralized matrix. In the presence of isobutylmethylxanthine, hydrocortisone, and indomethacin—agents that promote adipocyte differentiation—they accumulated fat droplets, but failed to express adipsin and aP2, markers of terminally differentiated adipocytes. Furthermore, they were converted back to matrix mineralizing cells when the adipogenic stimuli were replaced with the osteoblastogenic ones. A prototypic cell line with mixed phenotype (UAMS-33) expressed Osf2/Cbfa1—a transcription factor required for osteoblast differentiation, but not PPARγ2—a transcription factor required for terminal adipocyte differentiation. Stable transfection with a PPARγ2 expression construct and activation with the thiazolidinedione BRL49653 stimulated aP2 and adipsin synthesis and fat accumulation, and simultaneously suppressed Osf2/Cbfa1, α1(I) procollagen, and osteocalcin synthesis. Moreover, it rendered the cells incapable of forming a mineralized matrix. These results strongly suggest that PPARγ2 negatively regulates stromal cell plasticity by suppressing Osf2/Cbfa1 and osteoblast-like biosynthetic activity, while promoting terminal differentiation to adipocytes. J. Cell. Biochem. 74:357–371, 1999. © 1999 Wiley-Liss, Inc.
Interleukin-1 (IL-1) is markedly overexpressed in Alzheimer's disease. We found the IL-1A 2,2 genotype in 12.9% of 232 neuropathologically confirmed Alzheimer's disease patients and 6.6% of 167 controls from four centers in the United Kingdom and United States (odds ratio, 3.0; controlled for age and for ApoE [apolipoprotein E] genotype). Homozygosity for both allele 2 of IL-1A and allele 2 of IL-1B conferred even greater risk (odds ratio, 10.8). IL-1 genotypes may confer risk for Alzheimer's disease through IL-1 overexpression and IL-1-driven neurodegenerative cascades.
A polymerase chain reaction (PCR) assay for the rapid detection of Mycobacterium tuberculosis in sputum samples is described. The target DNA is a 123-base pair (bp) segment of IS6110, which is repeated in the M. tuberculosis chromosome and is specific for the M. tuberculosis complex. Methodology used to lyse the mycobacteria, extract the DNA, and amplify the 123-bp target DNA is presented. The amplified PCR product is detected by examination of ethidium-bromide-stained acrylamide gels. An internal control using the same primers as the target DNA has been constructed to assess the efficacy of each individual reaction. Of 162 sputum samples tested, 82 were smear-positive for acid-fast bacilli. Of the 94 specimens from patients in whom pulmonary tuberculosis was diagnosed, 51 were culture-positive, smear-positive, or both. Fifty of these were PCR positive. Of the 42 specimens from patients with nontuberculous mycobacterial pulmonary disease, 41 were PCR negative. All 26 specimens from patients without mycobacterial infection were PCR negative. This assay provides a sensitive and specific means for the laboratory diagnosis of tuberculosis within 48 h that is relatively simple to perform.
The metabolic activation of the food-borne rodent carcinogens 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-6-methyldipyrido[1,2-a:3',2'-d]imidazole (Glu-P-1) was compared with that of the known human carcinogen 4-aminobiphenyl (ABP), using human liver microsomes, human and rat liver cytosols, and human colon cytosol. All of these aromatic amines were readily activated by N-hydroxylation with human liver microsomes (2.3-5.3 nmol/min/mg protein), with PhIP and ABP exhibiting the highest rates of cytochrome P450IA2-dependent N-oxidation, followed by MeIQx, IQ and Glu-P-1. In contrast, while ABP and 2-aminofluorene were readily N-acetylated (1.7-2.3 nmol/min/mg protein) by the polymorphic human liver cytosolic N-acetyltransferase, none of the heterocyclic amines were detectable as substrates (less than 0.05 nmol/min/mg protein). Likewise, only low activity was observed (0.11 nmol/min/mg protein) for the N-acetylation of p-aminobenzoic acid, a selective substrate for the human monomorphic liver N-acetyltransferase. The radiolabeled N-hydroxy (N-OH) arylamine metabolites were synthesized and their reactivity with DNA was examined. Each derivative bound covalently with DNA at neutral pH (7.0), with highest levels of binding observed for N-OH-IQ and N-OH-PhIP. Incubation at acidic pH (5.0) resulted in increased levels of DNA binding, suggesting formation of reactive arylnitrenium ion intermediates. These N-OH arylamines were further activated to DNA-bound products by human hepatic O-acetyltransferase. Acetyl coenzyme A (AcCoA)-dependent, cytosol-catalyzed DNA binding was greatest for N-OH-ABP and N-OH-Glu-P-1, followed by N-OH-PhIP, N-OH-MeIQx and N-OH-IQ; and both rapid and slow acetylator phenotypes were apparent. Rat liver cytosol also catalyzed AcCoA-dependent DNA binding of the N-OH arylamines; and substrate specificities were comparable to human liver, except that N-OH-MeIQx and N-OH-PhIP gave relatively higher and lower activities respectively. Human colon cytosols likewise displayed AcCoA-dependent DNA binding activity for the N-OH substrates. Metabolic activity was generally lower than that found with the rapid acetylator liver cytosols; however, substrate specificity was variable and phenotypic differences in colon O-acetyltransferase activity could not be readily discerned. This may be due, at least in part, to the varied contribution of the monomorphic acetyltransferase, which would be expected to participate in the enzymatic acetylation of some of these N-OH arylamines.(ABSTRACT TRUNCATED AT 400 WORDS)
There is a high incidence of risk factors for incisional herniation in hospitalized veterans. Almost half the defects appear more than 12 months after celiotomy. "Buttonholing" of the rectus sheath by a sawing motion of the continuous nonabsorbable suture may be responsible for this later herniation. Suturing with synthetic, slowly absorbed monofilament may reduce delayed herniation. The recurrence rate after primary repair was 24.8% (n = 206), and after a second repair the recurrence rate was 41.7% (n = 36). Plastic prostheses, used only in difficult cases (18% of the sample), were associated with a recurrence rate similar to that associated with sutures because of protrusion around the edge. The use of larger and better fixed ("sandwich") polypropylene mesh (Marlex) is indicated. Subxiphoid epigastric hernias following sternotomy do not require prosthetic herniorrhaphy.
Castleman's disease (angiofollicular lymphoid hyperplasia) is a heterogeneous group of lymphoproliferative disorders of uncertain cause1. Two pathologic types, hyaline vascular and plasma-cell disease, have been recognized. The plasma-cell variant of Castleman's disease may be localized or multicentric. Multicentric disease is a systemic lymphoproliferative disorder characterized by lymphadenopathy, hepatosplenomegaly, and constitutional symptoms. Anemia, hypoalbuminemia, and hypergammaglobulinemia are also common. Interleukin-6, a cytokine with pleiotropic effects on the immune system, hematopoiesis, and acute-phase reactions, is a putative growth factor in multiple myeloma and may also be central to the pathophysiology of Castleman's disease2–7. Administration of a murine anti-interleukin-6 monoclonal . . .
BACKGROUND: Sentinel lymph node (SLN) biopsy is fast becoming the standard for testing lymph node involvement in many institutions. However, questions remain as to the best method of injection. The authors hypothesized that a subareolar injection of material would drain to the same lymph node as a peritumoral injection, regardless of the location of the tumor. METHODS: To test this theory, 68 patients with 69 operable invasive breast carcinomas and clinically node-negative disease were enrolled in this single-institution Institutional Review Board-approved trial. Patients were injected with 1.0 mCi of technetium-99 sulfur colloid (unfiltered) in the subareolar area of the tumor-bearing breast. Each patient received an injection of 2 to 5 cc of isosulfan blue around the tumor. Radioactive SLNs were identified using a hand-held gamma detector probe. RESULTS: The average age of patients entered into this trial was 55.2 +/- 13.4 years. The average size of the tumors was 1.48 +/- 1.0 cm. Thirty-two percent of the patients had undergone previous excisional breast biopsies. Of the 69 lesions, 62 (89.9%) had SLNs located with the blue dye and 65 (94.2%) with the technetium. In four patients, the SLN was not located with either method. All blue SLNs were also radioactive. All located SLNs were in the axilla. Of the 62 patients in which the SLNs were located with both methods, an average of 1.5 +/- 0.7 SLNs were found per patient, of which 23.2% had metastatic disease. All four patients in which no SLN was located with either method had undergone prior excisional biopsies. CONCLUSIONS: The results of this study suggest that subareolar injection of technetium is as accurate as peritumoral injection of blue dye. Central injection is easy and avoids the necessity for image-guided injection of nonpalpable breast lesions. Finally, subareolar injection of technetium avoids the problem of overlap of the radioactive zone of diffusion of the injection site with the radioactive sentinel lymph node, particularly in medial and upper outer quadrant lesions.
BACKGROUND: Troglitazone is a new oral antidiabetic drug that increases the sensitivity of peripheral tissues to insulin. It may therefore increase the efficacy of exogenous insulin in patients with insulin-resistant diabetes mellitus. METHODS: We studied the effect of troglitazone or placebo in 350 patients with poorly controlled non-insulin-dependent (type 2) diabetes mellitus (glycosylated hemoglobin values, 8 to 12 percent; normal, 4.3 to 6.1 percent) despite therapy with at least 30 U of insulin daily. The patients were randomly assigned to receive 200 mg of troglitazone (116 patients), 600 mg of troglitazone (116 patients), or placebo (118 patients) daily for 26 weeks. Insulin doses were not increased and were reduced only to prevent hypoglycemia. Glycosylated hemoglobin, serum glucose while fasting, serum total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, and triglycerides were measured 5 times during an 8-week base-line period and 10 times during the 26-week treatment period. Daily insulin doses were recorded during both periods. RESULTS: Ninety percent of the patients completed the study. The adjusted mean glycosylated hemoglobin values decreased by 0.8 and 1.4 percentage points, respectively, in the group given 200 mg of troglitazone and the group given 600 mg of troglitazone, and fasting serum glucose concentrations decreased by 35 and 49 mg per deciliter (1.9 and 2.7 mmol per liter), respectively, despite decreases in the insulin dose of 11 percent and 29 percent (P<0.001 for all comparisons with the placebo group). Serum total cholesterol, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol concentrations increased slightly and serum triglyceride concentrations decreased slightly in the troglitazone-treated patients. CONCLUSIONS: When given in conjunction with insulin, troglitazone improves glycemic control in patients with type 2 diabetes mellitus.
Considerable evidence supports a major inherited component of type 2 diabetes. We initially conducted a genome-wide scan with 440 microsatellite markers at 10-cM intervals in 19 multigenerational families of Northern European ancestry with at least two diabetic siblings. Initial two-point analyses of these families directed marker typing of 23 additional families. Subsequently, all available marker data on the total of 42 families were analyzed using both parametric and nonparametric multipoint methods to test for linkage to type 2 diabetes. One locus on chromosome 1q21-1q23 met genome-wide criteria for significant linkage under a model of recessive inheritance with a common diabetes allele (logarithm of odds [LOD] = 4.295). Both pedigree-based nonparametric linkage (NPL) analysis and affected sib pair (MAPMAKER/SIBS) nonparametric methods also showed the highest genome-wide scores at this region, near markers CRP and APOA2, but failed to meet levels of genome-wide significance. The risk of type 2 diabetes to siblings of a diabetic person when compared with the population (lambdaS) was estimated from MAPMAKER/SIBS to be 2.8 in these 42 families. Simulation studies using study data confirmed a genome-wide significance level of P<0.05 (95% CI 0.005-0.0466). However, analysis of 20 similarly ascertained but smaller families failed to confirm this linkage. The LOD score with 50% heterogeneity for all 62 families considered together was only 2.25, with an estimated lambdaS of 1.87. Our data suggest a novel diabetes susceptibility locus near APOA2 on chromosome 1 in a region with many transcribed genes.