Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis.

Eisenach, K.; Cave, M.; Bates, J.; T. Crawford, J.

doi:10.1093/INFDIS/161.5.977

Public

Polymerase Chain Reaction Amplification of a Repetitive DNA Sequence Specific for Mycobacterium tuberculosis

Shared by NobleBlocks on May 1, 1990 • 12:00 AM UTC

Authors:

Kathleen D. Eisenach

M. Donald Cave

Joseph H. Bates

Abstract

A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used...

Subject

Polymerase chain reaction

Mycobacterium tuberculosis

Sequence (biology)

Finding related papers...

Discussions

(0)

No comments yet

Be the first to share your thoughts!