James Paget University Hospitals NHS Foundation Trust
Hospital / health systemGreat Yarmouth, United Kingdom
Research output, citation impact, and the most-cited recent papers from James Paget University Hospitals NHS Foundation Trust (United Kingdom). Aggregated across the NobleBlocks index of 300M+ scholarly works.
Top-cited papers from James Paget University Hospitals NHS Foundation Trust
EPOS 2012: European position paper on rhinosinusitis and nasal polyps 2012. A summary for otorhinolaryngologists. no immunosuppressants IV D no nasal saline irrigation Ib, no data in single use D yes for symptomatic relief topical antibiotics no data D no anti-IL-5 no data D unclear phytotherapy no data D no decongestant topical / oral no data in single use D no mucolytics no data D no oral antihistamine in allergic patients no data D no antimycotics -topical Ia (-) ** A(-) no antimycotics -systemic Ib (-)# A(-) $ no anti leukotrienes Ib (-) A(-) no anti-IgE Ib (-) A(-) no * Some of these studies also included patients with CRS with nasal polyps. % short term antibiotics shows one positive and one negative study. Therefore recommendation C. oral antibiotic short term <4 weeks Ib(-) # A(-)* no intravenous antibiotics III(-) ## C(-) ** no # Ib (-): Ib study with a negative outcome.
Abstract The genetic make-up of an individual contributes to the susceptibility and response to viral infection. Although environmental, clinical and social factors have a role in the chance of exposure to SARS-CoV-2 and the severity of COVID-19 1,2 , host genetics may also be important. Identifying host-specific genetic factors may reveal biological mechanisms of therapeutic relevance and clarify causal relationships of modifiable environmental risk factors for SARS-CoV-2 infection and outcomes. We formed a global network of researchers to investigate the role of human genetics in SARS-CoV-2 infection and COVID-19 severity. Here we describe the results of three genome-wide association meta-analyses that consist of up to 49,562 patients with COVID-19 from 46 studies across 19 countries. We report 13 genome-wide significant loci that are associated with SARS-CoV-2 infection or severe manifestations of COVID-19. Several of these loci correspond to previously documented associations to lung or autoimmune and inflammatory diseases 3–7 . They also represent potentially actionable mechanisms in response to infection. Mendelian randomization analyses support a causal role for smoking and body-mass index for severe COVID-19 although not for type II diabetes. The identification of novel host genetic factors associated with COVID-19 was made possible by the community of human genetics researchers coming together to prioritize the sharing of data, results, resources and analytical frameworks. This working model of international collaboration underscores what is possible for future genetic discoveries in emerging pandemics, or indeed for any complex human disease.
OBJECTIVES: To examine whether rate of reoperation after breast conserving surgery is associated with patients' characteristics and investigate whether reoperation rates vary among English NHS trusts. DESIGN: Cohort study using patient level data from hospital episode statistics. SETTING: English NHS trusts. PARTICIPANTS: Adult women who had breast conserving surgery between 1 April 2005 and 31 March 2008. MAIN OUTCOME MEASURE: Reoperation rates after primary breast conserving surgery within 3 months, adjusted using logistic regression for tumour type, age, comorbidity, and socioeconomic deprivation. Tumours were grouped by whether a carcinoma in situ component was coded at the time of the primary breast conserving surgery. RESULTS: 55,297 women had primary breast conserving surgery in 156 NHS trusts during the three year period. 11,032 (20.0%, 95% confidence interval 19.6% to 20.3%) women had at least one reoperation. 10,212 (18.5%, 18.2% to 18.8%) had one reoperation only; of these, 5943 (10.7%, 10.5% to 11.0%) had another breast conserving procedure and 4269 (7.7%, 7.5% to 7.9%) had a mastectomy. Of the 45,793 women with isolated invasive disease, 8229 (18.0%) had at least one reoperation. In comparison, 2803 (29.5%) of the 9504 women with carcinoma in situ had at least one reoperation (adjusted odds ratio 1.9, 95% confidence interval 1.8 to 2.0). Substantial differences were found in the adjusted reoperation rates among the NHS trusts (10th and 90th centiles 12.2% and 30.2%). CONCLUSION: One in five women who had breast conserving surgery in England had a reoperation. Reoperation was nearly twice as likely when the tumour had a carcinoma in situ component coded. Women should be informed of this reoperation risk when deciding on the type of surgical treatment of their breast cancer.
Primary biliary cirrhosis (PBC) is a classical autoimmune liver disease for which effective immunomodulatory therapy is lacking. Here we perform meta-analyses of discovery data sets from genome-wide association studies of European subjects (n=2,764 cases and 10,475 controls) followed by validation genotyping in an independent cohort (n=3,716 cases and 4,261 controls). We discover and validate six previously unknown risk loci for PBC (Pcombined<5 × 10(-8)) and used pathway analysis to identify JAK-STAT/IL12/IL27 signalling and cytokine-cytokine pathways, for which relevant therapies exist.
BACKGROUND: The aim was to describe the management of benign gallbladder disease and identify characteristics associated with all-cause 30-day readmissions and complications in a prospective population-based cohort. METHODS: Data were collected on consecutive patients undergoing cholecystectomy in acute UK and Irish hospitals between 1 March and 1 May 2014. Potential explanatory variables influencing all-cause 30-day readmissions and complications were analysed by means of multilevel, multivariable logistic regression modelling using a two-level hierarchical structure with patients (level 1) nested within hospitals (level 2). RESULTS: Data were collected on 8909 patients undergoing cholecystectomy from 167 hospitals. Some 1451 cholecystectomies (16·3 per cent) were performed as an emergency, 4165 (46·8 per cent) as elective operations, and 3293 patients (37·0 per cent) had had at least one previous emergency admission, but had surgery on a delayed basis. The readmission and complication rates at 30 days were 7·1 per cent (633 of 8909) and 10·8 per cent (962 of 8909) respectively. Both readmissions and complications were independently associated with increasing ASA fitness grade, duration of surgery, and increasing numbers of emergency admissions with gallbladder disease before cholecystectomy. No identifiable hospital characteristics were linked to readmissions and complications. CONCLUSION: Readmissions and complications following cholecystectomy are common and associated with patient and disease characteristics.
Pancytopenia with hypocellular bone marrow is the hallmark of aplastic anaemia (AA) and the diagnosis is confirmed after careful evaluation, following exclusion of alternate diagnosis including hypoplastic myelodysplastic syndromes. Emerging use of molecular cyto-genomics is helpful in delineating immune mediated AA from inherited bone marrow failures (IBMF). Camitta criteria is used to assess disease severity, which along with age and availability of human leucocyte antigen compatible donor are determinants for therapeutic decisions. Supportive care with blood and platelet transfusion support, along with anti-microbial prophylaxis and prompt management of opportunistic infections remain key throughout the disease course. The standard first-line treatment for newly diagnosed acquired severe/very severe AA patients is horse anti-thymocyte globulin and ciclosporin-based immunosuppressive therapy (IST) with eltrombopag or allogeneic haemopoietic stem cell transplant (HSCT) from a matched sibling donor. Unrelated donor HSCT in adults should be considered after lack of response to IST, and up front for young adults with severe infections and a readily available matched unrelated donor. Management of IBMF, AA in pregnancy and in elderly require special attention. In view of the rarity of AA and complexity of management, appropriate discussion in multidisciplinary meetings and involvement of expert centres is strongly recommended to improve patient outcomes.
INTRODUCTION: In this article we look at the aetiology of plantar fasciitis, the other common differentials for heel pain and the evidence available to support each of the major management options. We also review the literature and discuss the condition. METHODS: A literature search was performed using PubMed and MEDLINE(®). The following keywords were used, singly or in combination: 'plantar fasciitis', 'plantar heel pain', 'heel spur'. To maximise the search, backward chaining of reference lists from retrieved papers was also undertaken. FINDINGS: Plantar fasciitis is a common and often disabling condition. Because the natural history of plantar fasciitis is not understood, it is difficult to distinguish between those patients who recover spontaneously and those who respond to formal treatment. Surgical release of the plantar fascia is effective in the small proportion of patients who do not respond to conservative measures. New techniques such as endoscopic plantar release and extracorporeal shockwave therapy may have a role but the limited availability of equipment and skills means that most patients will continue to be treated by more traditional techniques.
IntroductionMagseed is an alternative method of localising non-palpable breast lesions that has addressed many of the limitations of wire guided localisation (WGL). It consists of a paramagnetic seed that can be visualised on mammography and ultrasound. Intraoperative localisation of the seed is achieved with the use of the Sentimag probe. The aim of this study was to prospectively compare localisation in patients undergoing wide local excision (WLE) for non-palpable lesions between Magseed and WGL.MethodsWe prospectively collected data on all patients undergoing image-guided WLE between October 2017 and September 2018 in two academic breast units with a planned accrual of 100 consecutive patients undergoing Magseed localisation. Data was also collected on a cohort of 100 consecutive patients undergoing WGL in the same time period.ResultsDemographic and disease characteristics were well balanced between the two groups. 4/104 patients were converted preoperatively from Magseed to WGL (2 misplaced Magseeds; 2 undetected Magseeds). Intraoperative identification and excision of the localised lesion was successful in all patients as confirmed with specimen radiography. Overall no significant differences were observed in the proportion of patients requiring re-excision between the two groups (Magseed 16% vs. WGL 14% p = 0.692). Specimens size by weight and volume was similar for both groups (Magseed 39.6 g vs. WGL 44.5 g p = 0.206 and 90.1 cm3 for Magseed vs. 95.6 cm3 for WGL p = 0.579).ConclusionsIn our series Magseed localisation proved to be as reliable and effective as WGL in terms of lesion identification, excision with tumour free margins and specimen weight.
Anti tumour necrosis factor (anti-TNF) drugs increase the risk of serious respiratory infection and impair protective immunity following pneumococcal and influenza vaccination. Here we report SARS-CoV-2 vaccine-induced immune responses and breakthrough infections in patients with inflammatory bowel disease, who are treated either with the anti-TNF antibody, infliximab, or with vedolizumab targeting a gut-specific anti-integrin that does not impair systemic immunity. Geometric mean [SD] anti-S RBD antibody concentrations are lower and half-lives shorter in patients treated with infliximab than vedolizumab, following two doses of BNT162b2 (566.7 U/mL [6.2] vs 4555.3 U/mL [5.4], p <0.0001; 26.8 days [95% CI 26.2 - 27.5] vs 47.6 days [45.5 - 49.8], p <0.0001); similar results are also observed with ChAdOx1 nCoV-19 vaccination (184.7 U/mL [5.0] vs 784.0 U/mL [3.5], p <0.0001; 35.9 days [34.9 - 36.8] vs 58.0 days [55.0 - 61.3], p value < 0.0001). One fifth of patients fail to mount a T cell response in both treatment groups. Breakthrough SARS-CoV-2 infections are more frequent (5.8% (201/3441) vs 3.9% (66/1682), p = 0.0039) in patients treated with infliximab than vedolizumab, and the risk of breakthrough SARS-CoV-2 infection is predicted by peak anti-S RBD antibody concentration after two vaccine doses. Irrespective of the treatments, higher, more sustained antibody levels are observed in patients with a history of SARS-CoV-2 infection prior to vaccination. Our results thus suggest that adapted vaccination schedules may be required to induce immunity in at-risk, anti-TNF-treated patients.
BACKGROUND: Common sinonasal disorders include chronic rhinosinusitis (CRS), allergic rhinitis (AR), and a deviated nasal septum (DNS), which often coexist with shared common symptoms including nasal obstruction, olfactory dysfunction, and rhinorrhea. Various objective outcome measures and patient-reported outcome measures (PROMs) are used to assess disease severity; however, there is limited evidence in the literature on the correlation between them. This systematic review aims to examine the relationship between them and provide recommendations. METHODS: A search of MEDLINE and EMBASE identified studies quantifying correlations between objective outcome measures and PROMs for the sinonasal conditions using a narrative synthesis. RESULTS: In total, 59 studies met inclusion criteria. For nasal obstruction, rhinomanometry shows a lack of correlation whereas peak nasal inspiratory flow (PNIF) shows the strongest correlation with PROMs (r > 0.5). The Sniffin' Stick test shows a stronger correlation with PROMs (r > 0.5) than the University of Pennsylvania Smell Identification Test (UPSIT) (r < 0.5). Computed tomography (CT) sinus scores show little evidence of correlation with PROMs and nasal endoscopic ratings (weak correlation, r < 0.5). CONCLUSION: Overall, objective outcome measures and PROMs assessing sinonasal symptoms are poorly correlated, and we recommend that objective outcome measures be used with validated PROMs depending on the setting. PNIF should be used in routine clinical practice for nasal obstruction; rhinomanometry and acoustic rhinometry may be useful in research. The Sniffin' Sticks test is recommended for olfactory dysfunction with UPSIT as an alternative. CT scores should be excluded as a routine CRS outcome measure, and endoscopic scores should be used in combination with PROMs until further research is conducted.
OBJECTIVE: The 'Sniffin' Sticks' olfactory test contains pen-like odour dispensing devices which are used to assess olfactory threshold, discrimination and identification. Odour identification is strongly dependent on familiarity with the odours and has an important cultural component which has limited the usefulness of other validated tests. The 'Sniffin' Sticks' test was developed in Germany and is validated in other countries but not in the UK. This study aims to validate the applicability of 'Sniffin' Sticks' in a local population. DESIGN: Prospective controlled study. SETTING: Rhinology or olfactory disorder clinic. PARTICIPANTS: About 82 subjects, 33 healthy volunteers with a reported normal sense of smell, and 49 patients with an impaired sense of smell presenting either at a rhinology or an olfactory disorder clinic. Each subject's olfactory function was assessed using the 'Sniffin' Sticks' test with a maximum score of 48. MAIN OUTCOME MEASURES: Threshold, discrimination and identification scores along with the combined olfactory score. RESULTS: The mean age of the subjects tested was 46.7 years; 46 female and 36 male. In the patient group 36 were hyposmic and 13 anosmic. In the healthy volunteers group all subjects were normosmic. In the control group the mean combined olfactory score was 34.5 (±2.5). The mean combined score in the patients group was 20.8 (±7.4). Odour threshold scores were 3.7(±2.8) for patients (hyposmics and anomics) and 8.3(±1.8) for controls. In the identification test the controls mean score was 13.6 (±1.2) for while the patients' mean score was 8.6 (±3.5). CONCLUSIONS: In our sample of the local population the combined olfactory and odour identification scores for healthy volunteers and patients with olfactory disorders are comparable with the normative data published on large samples of European populations. However, modification of a few of the distracters is recommended for British patients based on our findings.
BACKGROUND: This study is part of the Chronic Rhinosinusitis Epidemiology Study (CRES). The overarching aim is to determine factors that influence the onset and severity of chronic rhinosinusitis (CRS). The aim of this analysis is to determine whether those with CRS are more likely to report psychiatric morbidity and in particular mood disturbance compared with healthy controls. METHODS: CRES consists of a study-specific questionnaire regarding demographic and socioeconomic factors and past medical history as well as a nasal symptom score (SNOT-22) and SF-36 (QoL - quality of life tool). Both of these tools contain mental health or emotional well-being domains. Participants were specifically asked whether they had ever consulted with their General Practitioner for anxiety or depression. Questionnaires were distributed to patients with CRS attending ENT outpatient clinics at 30 centres across the United Kingdom from 2007-2013. Controls were also recruited at these sites. Patients were divided into subgroups of CRS according to the absence/presence of polyps (CRSsNPs/CRSwNPs) or allergic fungal rhinosinusitis (AFRS). RESULTS: Consultations with a family physician for depression or anxiety were higher amongst those with CRS than controls, but this was only significant for those with CRSsNPs. Odds ratio (OR) for CRSsNPs vs controls: 1.89; OR for CRSwNPs: 1.40. Patients with CRS showed significantly higher mental health morbidity than controls across the mental health and emotional wellbeing domains of the SF-36 and SNOT-22. Mean difference in the mental health domain of SF-36 was 8.3 for CRSsNPs and 5.3 for CRSwNPs. For the emotional domain of SNOT-22, differences were 7.7 and 6.3 respectively. CONCLUSIONS: Depression and anxiety are significantly more common in patients with CRS compared to healthy controls, especially in those with CRSsNPs. This added mental health morbidity needs consideration when managing these patients in primary and secondary care settings.
OBJECTIVES: To explore patient views and perspectives of current management of chronic rhinosinusitis (CRS) in primary and secondary care. DESIGN: Semistructured qualitative telephone interviews as part of the MACRO programme (Defining best Management for Adults with Chronic RhinOsinusitis). SETTING: Primary care and secondary care ear, nose and throat outpatient clinics in the UK. PARTICIPANTS: Twenty-five patients consented to in-depth telephone interviews. Transcribed recordings were managed using NVivo software and analysed using inductive thematic analysis. RESULTS: CRS has a significant impact on patients' quality of life, affecting their ability to work effectively, their social interactions and daily living. Patients seek help when symptoms become unmanageable, but can become frustrated with the primary care system with difficulties obtaining an appointment, and lack of continuity of care. Patients perceive that general practitioners can be dismissive of CRS symptoms, and patients often prioritise other concerns when they consult. Health system barriers and poor communication can result in delays in accessing appropriate treatment and referral. Adherence to intranasal steroids is a problem and patients are uncertain about correct technique. Nasal irrigation can be time-consuming and difficult for patients to use. Secondary care consultations can appear rushed, and patients would like specialists to take a more 'holistic' approach to their management. Surgery is often considered a temporary solution, appropriate when medical options have been explored. CONCLUSIONS: Patients are frustrated with the management of their CRS, and poor communication can result in delays in receiving appropriate treatment and timely referral. Patients seek better understanding of their condition and guidance to support treatments decisions in light of uncertainties around the different medical and surgical options. Better coordinated care between general practice and specialist settings and consistency of advice has the potential to increase patient satisfaction and improve outcomes.
Homozygous variegate porphyria is a severe skin and neurologic disease manifesting in early infancy, and characterized by markedly reduced levels of the penultimate enzyme in the heme biosynthetic pathway, protoporphyrinogen oxidase. We investigated the molecular basis of variegate porphyria, usually an autosomal dominantly inherited trait, in a severely affected female proband and her parents. The mutation detection strategy included heteroduplex analysis, automated sequencing, and allele specific oligonucleotide hybridization. We identified two underlying missense mutations in the protoporphyrinogen oxidase gene, consisting of a G-to-A transition in exon 6 (G169E), and a G-to-A transition in exon 10 (G358R). Our study establishes the molecular basis of “homozygous” variegate porphyria for the first time, in demonstrating that this patient is a compound heterozygote for two different missense mutations in the protoporphyrinogen oxidase gene. Homozygous variegate porphyria is a severe skin and neurologic disease manifesting in early infancy, and characterized by markedly reduced levels of the penultimate enzyme in the heme biosynthetic pathway, protoporphyrinogen oxidase. We investigated the molecular basis of variegate porphyria, usually an autosomal dominantly inherited trait, in a severely affected female proband and her parents. The mutation detection strategy included heteroduplex analysis, automated sequencing, and allele specific oligonucleotide hybridization. We identified two underlying missense mutations in the protoporphyrinogen oxidase gene, consisting of a G-to-A transition in exon 6 (G169E), and a G-to-A transition in exon 10 (G358R). Our study establishes the molecular basis of “homozygous” variegate porphyria for the first time, in demonstrating that this patient is a compound heterozygote for two different missense mutations in the protoporphyrinogen oxidase gene. protoporphyrinogen oxidase variegate porphyria The porphyrias are disorders of heme metabolism resulting from the inherited or acquired dysregulation of one of the eight enzymes that control the porphyrin-heme biosynthetic pathway. Variegate porphyria (VP), one of the acute hepatic porphyrias, is characterized by a partial defect in the activity of protoporphyrinogen oxidase (PPO), the penultimate enzyme in the heme biosynthetic pathway (Frank and Christiano, 1997Frank J. Christiano A.M. Genetic research strategies: a review of the acute porphyrias.Retinoids. 1997; 13: 88-92Google Scholar). VP is usually inherited as an autosomal dominant trait, displaying incomplete penetrance, as not all persons carrying a mutation in the PPO gene develop the clinical phenotype (Frank and Christiano, 1997Frank J. Christiano A.M. Genetic research strategies: a review of the acute porphyrias.Retinoids. 1997; 13: 88-92Google Scholar). In heterozygotes, PPO activity is decreased by ≈50%. Homozygous VP is a very rare recessive disease, presenting with residual PPO levels between 5 and 20%, and to date only a few cases have been reported (Kordac et al., 1984Kordac V. Deybach J.C.H. Martasek P. et al.Homozygous variegate porphyria.Lancet. 1984; 11: 851Abstract Scopus (27) Google Scholar; Murphy et al., 1986Murphy G.M. Magnus I.A. Barrett D.R. Elder G.H. Hawk J.L.M. Smith S.G. Homozygous variegate porphyria: two similar cases in unrelated families.J R Soc Med. 1986; 79: 361-363PubMed Google Scholar; Mustajoki et al., 1987Mustajoki P. Tenhunen R. Niemi K.M. Nordmann Y. Kääriäinen H. Norio R. Homozygous variegate porphyria: A severe skin disease of infancy.Clin Genet. 1987; 32: 300-305Crossref PubMed Scopus (20) Google Scholar; Norris et al., 1990Norris P.G. Elder G.H. Hawk J.L.M. Homozygous variegate porphyria: a case report.Br J Derm. 1990; 122: 253-257Crossref PubMed Scopus (23) Google Scholar; Coakley et al., 1990Coakley J. Hawkins R. Crinis N. et al.An unusual case of variegate porphyria with possible homozygous inheritance.Aust NZ J Med. 1990; 20: 587-589Crossref PubMed Scopus (11) Google Scholar; Gandolfo et al., 1991Gandolfo L.D. Macri A. Biolcati G. et al.Homozygous variegate porphyria: revision of a diagnostic error.Br J Derm. 1991; 124: 211,Crossref Scopus (7) Google Scholar; Hift et al., 1993Hift R.J. Meissner P.N. Todd G. et al.Homozygous variegate porphyria: an evolving clinical syndrome.Postgrad Med J. 1993; 69: 781-786Crossref PubMed Scopus (48) Google Scholar). Clinically, VP is characterized by cutaneous manifestations, including increased photosensitivity, blistering, skin fragility with chronic scarring of sun-exposed areas, and postinflammatory hyperpigmentation (Dean, 1971Dean G. The Porphyrias. 2nd edn. Pitman Medical, London1971Google Scholar). Acute exacerbations of VP include abdominal pain, the passage of dark urine, and neuropsychiatric symptoms that characterize the acute hepatic porphyrias, such as bulbar paralysis, quadriplegia, motor neuropathy, and weakness of the limbs (Frank and Christiano, 1997Frank J. Christiano A.M. Genetic research strategies: a review of the acute porphyrias.Retinoids. 1997; 13: 88-92Google Scholar). In heterozygotes, the disease does not usually present before puberty (Coakley et al., 1990Coakley J. Hawkins R. Crinis N. et al.An unusual case of variegate porphyria with possible homozygous inheritance.Aust NZ J Med. 1990; 20: 587-589Crossref PubMed Scopus (11) Google Scholar), whereas homozygous patients develop severe symptoms in early infancy (Hift et al., 1993Hift R.J. Meissner P.N. Todd G. et al.Homozygous variegate porphyria: an evolving clinical syndrome.Postgrad Med J. 1993; 69: 781-786Crossref PubMed Scopus (48) Google Scholar). The human PPO cDNA and gene were recently cloned and mapped to chromosome 1q22–23 (Nishimura et al., 1995Nishimura K. Taketani S. Inokuchi H. Cloning of a human cDNA for protoporphyrinogen oxidase by complementation in vivo of a hem G mutant of Escherichia coli..J Biol Chem. 1995; 270: 8076-8080Crossref PubMed Scopus (94) Google Scholar; Roberts et al., 1995Roberts A.G. Whatley S.D. Daniels J. et al.Partial characterization and assignment of the gene for protoporphyrinogen oxidase and variegate porphyria to human chromosome 1q23.Hum Molec Genet. 1995; 4: 2387-2390Crossref PubMed Scopus (59) Google Scholar; Taketani et al., 1995aTaketani S. Inazawa J. Abe T. et al.The human protoporphyrinogen oxidase gene (PPOX): Organization and location to chromosome 1.Genomics. 1995; 29: 698-703Crossref PubMed Scopus (80) Google Scholar), and we and others have recently identified pathogenetic mutations in several families with VP (Deybach et al., 1996Deybach J.C. Puy H. Robreau A.M. Lamoril J. Da Silva V. Grandchamp B. Nordmann Y. Mutations in the protoporphyrinogen oxidase gene in patients with variegate porphyria.Hum Mol Genet. 1996; 5: 407-410Crossref PubMed Scopus (57) Google Scholar; Meissner et al., 1996Meissner P.N. Dailey T.A. Hift R.J. et al.A R59W mutation in human protoporphyrinogen oxidase results in decreased enzyme activity and is prevalent in South Africans with variegate porphyria.Nat Genet. 1996; 13: 95-97Crossref PubMed Scopus (188) Google Scholar; Warnich et al., 1996Warnich L. Kotze M.J. Groenewald I.M. et al.Identification of three mutations and associated haplotypes in the protoporphyrinogen oxidase gene in South African families with variegate porphyria.Hum Mol Genet. 1996; 5: 981-984Crossref PubMed Scopus (77) Google Scholar; Lam et al., 1997Lam H. Dragan L. Tsou H.C. et al.Molecular basis of variegate porphyria: A de novo insertion mutation in the protoporphyrinogen oxidase gene.Hum Genet. 1997; 99: 126-129Crossref PubMed Scopus (21) Google Scholar; Frank and Christiano, 1997Frank J. Christiano A.M. Genetic research strategies: a review of the acute porphyrias.Retinoids. 1997; 13: 88-92Google Scholar). In this study, we investigated a proband who was diagnosed with “homozygous” VP in 1989 (Norris et al., 1990Norris P.G. Elder G.H. Hawk J.L.M. Homozygous variegate porphyria: a case report.Br J Derm. 1990; 122: 253-257Crossref PubMed Scopus (23) Google Scholar), and her clinically unaffected parents. We identified a G-to-A transition in exon 6 and a G-to-A transition in exon 10 of the PPO gene, resulting in the substitution of glycine by glutamic acid (G169E) on the paternal PPO allele, and glycine by arginine (G358R) on the maternal allele, respectively. Our study establishes, for the first time, that this patient is a compound heterozygote for two different missense mutations in the PPO gene and thereby offers a molecular explanation for the autosomal recessive “homozygous” form of VP. The patient, her parents, and 50 unrelated unaffected controls were investigated in this study. Diagnosis of VP in the patient was established by one of us (J.L.M. Hawk) in a previously published investigation (Norris et al., 1990Norris P.G. Elder G.H. Hawk J.L.M. Homozygous variegate porphyria: a case report.Br J Derm. 1990; 122: 253-257Crossref PubMed Scopus (23) Google Scholar). The now 20 y old female proband was the daughter of nonconsanguineous parents with no family history of porphyria. Blood samples from the proband (Figure 1a) and her parents were collected in tubes containing ethylenediamine tetraacetic acid. All individuals provided informed consent for inclusion in the investigation, in accordance with guidelines set forth by the local institutional review board. Genomic DNA was isolated according to standard techniques (Sambrook et al., 1989Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York1989Google Scholar). A mutation detection strategy was developed for PCR amplification of all PPO exons using PCR primers that were published recently (Warnich et al., 1996Warnich L. Kotze M.J. Groenewald I.M. et al.Identification of three mutations and associated haplotypes in the protoporphyrinogen oxidase gene in South African families with variegate porphyria.Hum Mol Genet. 1996; 5: 981-984Crossref PubMed Scopus (77) Google Scholar). For amplification of exon 6 of the PPO gene, the following primers were used: PPO exon 6L, 5′GGGCTGTGGAAATCAGTCAG3′; and PPO exon 6R, 5′TTCACCCTCTGAATCGATCC3′. For amplification of exon 10 of the PPO gene, the following primers were used: PPO exon 10L, 5′AGAGCCCTTTCCTTCTGACGCATG3′; and PPO exon 10R, 5′TGGCCTTGCCTACAATGGAGCAC3′. PCR was carried out on genomic DNA from all family members according to the following program: 95°C for 10 min; followed by 40 cycles of 95°C for 45 s, 57°C for 45 s, and 72°C for 1 min; followed by 72°C for 15 min, in an OmniGene thermal cycler (Marsh Scientific, Rochester, NY). For mutation detection, PCR products were subjected to conformation sensitive gel electrophoresis (CSGE) analysis as described previously (Ganguly et al., 1993Ganguly A. Rock M.J. Prockop D.J. Conformation-sensitive gel electrophoresis for rapid detection of single-base differences in double-stranded PCR products and DNA fragments: Evidence for solvent-induced bends in DNA heteroduplexes.Proc Natl Acad Sci USA. 1993; 90: 10325-10329Crossref PubMed Scopus (619) Google Scholar). PCR products displaying a heteroduplex on CSGE analysis were sequenced automatically using an ABI Prism 310 Genetic Analyzer. To verify the mutations, allele specific oligonucleotide hybridization was performed according to standard techniques (Sambrook et al., 1989Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York1989Google Scholar). In this case, the following oligonucleotides were used: Oligo exon 6 mutant, 5′TCTGCCGTGAAGTGTTTGCA3′; and Oligo exon 6 wild-type, 5′TCTGCCGTGGAGTGTTTGC3′. Oligo exon 10 mutant, 5′AGCAGGACAGGAGCCCC3′; and Oligo exon 10 wild-type, 5′GCAGGACGGGAGCCCC3′. Heteroduplex analysis of exon 6 of the PPO gene in this family revealed a heteroduplex in the proband and her father (Figure 1b). Automated sequencing of the PCR product of exon 6 revealed a similar sequence deviation in the proband and her father (Figure 1c). The mutation consisted of a G-to-A transition at nucleotide 505 of the PPO cDNA (numbered according to GenBank #D38537). This base substitution leads to a missense mutation consisting of an amino acid change from glycine to glutamic acid at position 169 (G169E) in the deduced amino acid sequence on the paternal allele. Heteroduplex analysis of exon 10 of the PPO gene in this family revealed a heteroduplex in the proband and her mother (Figure 1b). Automated sequence analysis of the PCR product of exon 10 showed the same sequence variant in the proband and her mother (Figure 1c). The mutation consisted of a G-to-A transition at nucleotide 1071 of the PPO cDNA (numbered according to GenBank #D38537). This base change results in a missense mutation causing an amino acid substitution from glycine to arginine at position 358 (G358R) in the deduced amino acid sequence on the maternal allele. Heteroduplex analysis of exon 6 and exon 10 of the PPO gene was also carried out in 50 unrelated control individuals and showed no heteroduplex formation indicative of the mutation, suggesting that these sequence variations are not common polymorphisms in the PPO gene (data not shown). To verify the sequence variations in exon 6 and exon 10, allele specific oligonucleotide hybridization was performed (Figure 1e). Furthermore, all remaining PPO exons of the patient and her parents were checked for additional sequence variants but revealed no other mutations. The proband revealed raised erythrocyte protoporphyrin levels with the protoporphyrin being predominantly zinc-chelated (Norris et al., 1990Norris P.G. Elder G.H. Hawk J.L.M. Homozygous variegate porphyria: a case report.Br J Derm. 1990; 122: 253-257Crossref PubMed Scopus (23) Google Scholar) and PPO activity measured in Epstein–Barr virus transformed lymphoblasts was decreased to less than 20%, whereas both parents had approximately half-normal levels of PPO (Norris et al., 1990Norris P.G. Elder G.H. Hawk J.L.M. Homozygous variegate porphyria: a case report.Br J Derm. 1990; 122: 253-257Crossref PubMed Scopus (23) Google Scholar) (Table 1).Table 1Results of measurement of porphyrins and their precursors in the patient’s urine, stool, erythrocytes lymphoblasts according to Norris et al (1990)ProbandFatherMotherReference rangesUrineUroporphyrin (μg per liter)145––0–18Coproporphyrin (μg per liter)184––0–149StoolCoproporphyrin (μg per g dry weight)1318130–30Protoporphyrin (μg per g dry weight)17112170–125Ether insoluble (X) porphyrin (μg per dry weight)332550–20ErythrocytesTotal porphyrin (μg per dl)645741210–95LymphoblastsPPO enzyme activity (nmol protoporphyrin per hour per mg protein)0.060.280.290.38–0.47 Open table in a new tab Only 10 patients with the diagnosis of “homozygous” VP have been reported (Kordac et al., 1984Kordac V. Deybach J.C.H. Martasek P. et al.Homozygous variegate porphyria.Lancet. 1984; 11: 851Abstract Scopus (27) Google Scholar; Murphy et al., 1986Murphy G.M. Magnus I.A. Barrett D.R. Elder G.H. Hawk J.L.M. Smith S.G. Homozygous variegate porphyria: two similar cases in unrelated families.J R Soc Med. 1986; 79: 361-363PubMed Google Scholar; Mustajoki et al., 1987Mustajoki P. Tenhunen R. Niemi K.M. Nordmann Y. Kääriäinen H. Norio R. Homozygous variegate porphyria: A severe skin disease of infancy.Clin Genet. 1987; 32: 300-305Crossref PubMed Scopus (20) Google Scholar; Norris et al., 1990Norris P.G. Elder G.H. Hawk J.L.M. Homozygous variegate porphyria: a case report.Br J Derm. 1990; 122: 253-257Crossref PubMed Scopus (23) Google Scholar; Coakley et al., 1990Coakley J. Hawkins R. Crinis N. et al.An unusual case of variegate porphyria with possible homozygous inheritance.Aust NZ J Med. 1990; 20: 587-589Crossref PubMed Scopus (11) Google Scholar; Gandolfo et al., 1991Gandolfo L.D. Macri A. Biolcati G. et al.Homozygous variegate porphyria: revision of a diagnostic error.Br J Derm. 1991; 124: 211,Crossref Scopus (7) Google Scholar; Hift et al., 1993Hift R.J. Meissner P.N. Todd G. et al.Homozygous variegate porphyria: an evolving clinical syndrome.Postgrad Med J. 1993; 69: 781-786Crossref PubMed Scopus (48) Google Scholar), indicating that this variant of VP is very rare. These 10 cases were reported at a time when the genetic lesions in the PPO gene were not yet identified, so that making a DNA based diagnosis was not possible. Therefore, at that time, diagnosis of “homozygous” VP was made by the severe clinical findings in the patients and biochemical analyses; however, Hift et al, postulated in 1993 that some of the cases of “homozygous” VP would be compound heterozygotes rather than true homozygotes (Hift et al., 1993Hift R.J. Meissner P.N. Todd G. et al.Homozygous variegate porphyria: an evolving clinical syndrome.Postgrad Med J. 1993; 69: 781-786Crossref PubMed Scopus (48) Google Scholar). In support of this notion, our results demonstrate that the “homozygous” VP patient reported by Norris et al., 1990Norris P.G. Elder G.H. Hawk J.L.M. Homozygous variegate porphyria: a case report.Br J Derm. 1990; 122: 253-257Crossref PubMed Scopus (23) Google Scholar is indeed a compound heterozygote. Twelve mutations have been identified to date in the PPO gene (Table 2) (Deybach et al., 1996Deybach J.C. Puy H. Robreau A.M. Lamoril J. Da Silva V. Grandchamp B. Nordmann Y. Mutations in the protoporphyrinogen oxidase gene in patients with variegate porphyria.Hum Mol Genet. 1996; 5: 407-410Crossref PubMed Scopus (57) Google Scholar; Meissner et al., 1996Meissner P.N. Dailey T.A. Hift R.J. et al.A R59W mutation in human protoporphyrinogen oxidase results in decreased enzyme activity and is prevalent in South Africans with variegate porphyria.Nat Genet. 1996; 13: 95-97Crossref PubMed Scopus (188) Google Scholar; Warnich et al., 1996Warnich L. Kotze M.J. Groenewald I.M. et al.Identification of three mutations and associated haplotypes in the protoporphyrinogen oxidase gene in South African families with variegate porphyria.Hum Mol Genet. 1996; 5: 981-984Crossref PubMed Scopus (77) Google Scholar; Lam et al., 1997Lam H. Dragan L. Tsou H.C. et al.Molecular basis of variegate porphyria: A de novo insertion mutation in the protoporphyrinogen oxidase gene.Hum Genet. 1997; 99: 126-129Crossref PubMed Scopus (21) Google Scholar; Frank and Christiano, 1997Frank J. Christiano A.M. Genetic research strategies: a review of the acute porphyrias.Retinoids. 1997; 13: 88-92Google Scholar). The paternal mutation detected in this study is a G-to-A transition in exon 6 of the PPO gene, designated G169E. Three lines of evidence support the notion that this base substitution is responsible for VP in this severely affected proband. First, it causes an amino acid change from a neutral glycine residue to a negatively charged glutamic acid residue at position 169 (G169E) on the paternal allele of the PPO gene that may destabilize specific interactions in PPO and impair proper functioning of the protein. Second, a comparison of deduced amino acid sequences (Figure 2a) revealed this glycine residue to be strictly conserved through evolution in human (Nishimura et al., 1995Nishimura K. Taketani S. Inokuchi H. Cloning of a human cDNA for protoporphyrinogen oxidase by complementation in vivo of a hem G mutant of Escherichia coli..J Biol Chem. 1995; 270: 8076-8080Crossref PubMed Scopus (94) Google Scholar), mouse (Taketani et al., 1995bTaketani S. Yoshinaga T. Furukawa T. Kohno H. Tokunaga R. Nishimura K. Inokuchi H. Induction of terminal enzymes for heme biosynthesis during differentiation of mouse erythroleukemia cells.Eur J Biochem. 1995; 230: 760-765Crossref PubMed Scopus (36) Google Scholar), Bacillus subtilis (Taketani et al., 1995bTaketani S. Yoshinaga T. Furukawa T. Kohno H. Tokunaga R. Nishimura K. Inokuchi H. Induction of terminal enzymes for heme biosynthesis during differentiation of mouse erythroleukemia cells.Eur J Biochem. 1995; 230: 760-765Crossref PubMed Scopus (36) Google Scholar), and Saccharomyces cerevisiae (Camadro and Labbe, 1996Camadro J.M. Labbe P. Cloning and characterization of the yeast HEM14 coding for protoporphyrinogen oxidase, the molecular target of diphenyl ether-type herbicides.J Biol Chem. 1996; 271: 9120-9128Crossref PubMed Scopus (37) Google Scholar), although their entire amino acid sequence identity is less than 20%. Third, no other deviation in the father’s cDNA sequence of the PPO gene was detected.Table 2Mutations in the PPO gene reported to dateDesignationLocationConsequenceReferenceDominant VP1083delTexon 10Frameshift mutationFrank and Christiano, 1997Frank J. Christiano A.M. Genetic research strategies: a review of the acute porphyrias.Retinoids. 1997; 13: 88-92Google Scholar165insAGexon 3Frameshift mutationLam et al, 19971144del GTexon 11Frameshift mutationFrank and Christiano, 1997Frank J. Christiano A.M. Genetic research strategies: a review of the acute porphyrias.Retinoids. 1997; 13: 88-92Google Scholar1022insGexon 7Frameshift mutationDeybach et al, 1996S450Pexon 13Missense mutationFrank and Christiano, 1997Frank J. Christiano A.M. Genetic research strategies: a review of the acute porphyrias.Retinoids. 1997; 13: 88-92Google ScholarG232Rexon 7Missense mutationDeybach et al, 1996H20Pexon 2Missense mutationWarnich et al, 1996R59Wexon 3Missense mutationMeissner et al, 1996 Warnich et al, mutationMeissner et al, 1996 Warnich et al, mutationFrank et al., J. K. G. Christiano A.M. Variegate porphyria: of a mutation in the protoporphyrinogen oxidase PubMed Scopus Google heterozygote missense study Open table in a new tab The maternal mutation consisted of a G-to-A transition in exon 10 of the PPO gene, designated glycine is a neutral amino acid whereas arginine is this mutation is also to and of the protein. A comparison of deduced amino acid sequences (Figure showed that this glycine residue is conserved in human and mouse other was in the coding sequence of the PPO gene. VP is inherited in an autosomal dominant (Frank and Christiano, 1997Frank J. Christiano A.M. Genetic research strategies: a review of the acute porphyrias.Retinoids. 1997; 13: 88-92Google Scholar). In this study, however, we that disease in this family is autosomal carried one mutation and had a reduced activity (Table of the mutations the activity of however, family history not clinical symptoms of VP. is not yet some of mutations in the PPO gene develop the clinical phenotype and others In this case, the affected proband was a compound heterozygote for the mutations and revealed markedly reduced PPO activity and severe clinical symptoms (Norris et al., 1990Norris P.G. Elder G.H. Hawk J.L.M. Homozygous variegate porphyria: a case report.Br J Derm. 1990; 122: 253-257Crossref PubMed Scopus (23) Google Scholar). we that of two missense mutations leads to a biochemical defect that to a severe phenotype with clinical findings that are not present in VP The clinically severe recessive form of VP described to the “homozygous” of and porphyria reported previously et al., B. N. Nordmann Y. Homozygous case of Scopus Google Scholar; Elder et al., G.H. Smith S.G. et a new defect or homozygous porphyria Scopus Google Scholar; et al., G. K. S. of with PubMed Scopus Google Scholar; and recessive a of severe and J Med. 1995; Scholar). that such a of disease is associated with a severe clinical only in the reported cases with “homozygous” VP does the clinical phenotype include and (Hift et al., 1993Hift R.J. Meissner P.N. Todd G. et al.Homozygous variegate porphyria: an evolving clinical syndrome.Postgrad Med J. 1993; 69: 781-786Crossref PubMed Scopus (48) Google Scholar), as a of the enzyme We that with this inherited variant of VP are at for the of severe clinical only “homozygous” VP patients protoporphyrin levels in the with the protoporphyrin being predominantly zinc-chelated (Hift et al., 1993Hift R.J. Meissner P.N. Todd G. et al.Homozygous variegate porphyria: an evolving clinical syndrome.Postgrad Med J. 1993; 69: 781-786Crossref PubMed Scopus (48) Google Scholar), whereas VP patients This of protoporphyrin was also reported in cases of homozygous porphyria et al., G.H. Smith S.G. et a new defect or homozygous porphyria Scopus Google Scholar) and in homozygous et al., Y. Grandchamp B. de H. a variant Scopus Google Scholar), and to be a of severe in the porphyrin-heme biosynthetic pathway. This study establishes the molecular basis of “homozygous” VP for the first are to the molecular basis of by the of mutant and additional and unusual of of the These the basis for the of as a for VP in the We are to the patient and her family for their and in this study. We the of G.H. Elder of of of to the biochemical of our patient’s porphyria. This study was by from the and the
Abstract Background The aims of this prospective population-based cohort study were to identify the patient and hospital characteristics associated with emergency cholecystectomy, and the influences of these in determining variations between hospitals. Methods Data were collected for consecutive patients undergoing cholecystectomy in acute UK and Irish hospitals between 1 March and 1 May 2014. Potential explanatory variables influencing the performance of emergency cholecystectomy were analysed by means of multilevel, multivariable logistic regression modelling using a two-level hierarchical structure with patients (level 1) nested within hospitals (level 2). Results Data were collected on 4744 cholecystectomies from 165 hospitals. Increasing age, lower ASA fitness grade, biliary colic, the need for further imaging (magnetic retrograde cholangiopancreatography), endoscopic interventions (endoscopic retrograde cholangiopancreatography) and admission to a non-biliary centre significantly reduced the likelihood of an emergency cholecystectomy being performed. The multilevel model was used to calculate the probability of receiving an emergency cholecystectomy for a woman aged 40 years or over with an ASA grade of I or II and a BMI of at least 25·0 kg/m2, who presented with acute cholecystitis with an ultrasound scan showing a thick-walled gallbladder and a normal common bile duct. The mean predicted probability of receiving an emergency cholecystectomy was 0·52 (95 per cent c.i. 0·45 to 0·57). The predicted probabilities ranged from 0·02 to 0·95 across the 165 hospitals, demonstrating significant variation between hospitals. Conclusion Patients with similar characteristics presenting to different hospitals with acute gallbladder pathology do not receive comparable care.
OBJECTIVE: A cholesteatoma is a mass of keratinising epithelium in the middle ear. It is a rare disorder that is associated with significant morbidity, and its causative risk factors are poorly understood; on a global scale, up to a million people are affected by this each year. We have conducted a systematic literature review to identify reports about the heritability of cholesteatoma or any constitutional genetic factors that may be associated with its aetiology. DATA SOURCES: A systematic search of MEDLINE (EBSCO) and two databases of curated genetic research (OMIM and Phenopedia) was conducted. STUDY SELECTION: The participants and populations of interest for this review were people treated for cholesteatoma and their family members. The studies of interest reported evidence of heritability for the trait, or any association with congenital syndromes and particular genetic variants. DATA EXTRACTION: The searches identified 449 unique studies, of which 35 were included in the final narrative synthesis. DATA SYNTHESIS: A narrative synthesis was conducted, and data were tabulated to record characteristics, including study design, genetic data and author conclusions. Most of the studies identified in the literature search, and described here, are case reports and so represent the lowest level of evidence. In a few case reports, congenital and acquired cholesteatomas have been shown to segregate within families in the pattern typical of a monogenic or oligogenic disorder with incomplete penetrance. Evidence from syndromic cases could suggest that genes controlling ear morphology may be risk factors for cholesteatoma formation. CONCLUSIONS: This is the first systematic review about the genetics of cholesteatoma, and we have identified a small body of relevant literature that provides evidence of a heritable component for its aetiology. Cholesteatoma is a complex and heterogeneous clinical phenotype, and it is often associated with chronic otitis media and with some rare congenital syndromes known to affect ear morphology and related pathologies.
BACKGROUND: The optimal timing of cholecystectomy for patients admitted with acute gallbladder pathology is unclear. Some studies have shown that emergency cholecystectomy during the index admission can reduce length of hospital stay with similar rates of conversion to open surgery, complications and mortality compared with a 'delayed' operation following discharge. Others have reported that cholecystectomy during the index acute admission results in higher morbidity, extended length of stay and increased costs. This study examined the cost-effectiveness of emergency versus delayed cholecystectomy for acute benign gallbladder disease. METHODS: Using data from a prospective population-based cohort study examining the outcomes of cholecystectomy in the UK and Ireland, a model-based cost-utility analysis was conducted from the perspective of the UK National Health Service, with a 1-year time horizon for costs and outcomes. Probabilistic sensitivity analysis was used to investigate the impact of parameter uncertainty on the results obtained from the model. RESULTS: Emergency cholecystectomy was found to be less costly (£4570 versus £4720; €5484 versus €5664) and more effective (0·8868 versus 0·8662 QALYs) than delayed cholecystectomy. Probabilistic sensitivity analysis showed that the emergency strategy is more than 60 per cent likely to be cost-effective across willingness-to-pay values for the QALY from £0 to £100 000 (€0-120 000). CONCLUSION: Emergency cholecystectomy is less costly and more effective than delayed cholecystectomy. This approach is likely to be beneficial to patients in terms of improved health outcomes and to the healthcare provider owing to the reduced costs.
High bone mass (HBM) can be an incidental clinical finding; however, monogenic HBM disorders (eg, LRP5 or SOST mutations) are rare. We aimed to determine to what extent HBM is explained by mutations in known HBM genes. A total of 258 unrelated HBM cases were identified from a review of 335,115 DXA scans from 13 UK centers. Cases were assessed clinically and underwent sequencing of known anabolic HBM loci: LRP5 (exons 2, 3, 4), LRP4 (exons 25, 26), SOST (exons 1, 2, and the van Buchem's disease [VBD] 52-kb intronic deletion 3'). Family members were assessed for HBM segregation with identified variants. Three-dimensional protein models were constructed for identified variants. Two novel missense LRP5 HBM mutations ([c.518C>T; p.Thr173Met], [c.796C>T; p.Arg266Cys]) were identified, plus three previously reported missense LRP5 mutations ([c.593A>G; p.Asn198Ser], [c.724G>A; p.Ala242Thr], [c.266A>G; p.Gln89Arg]), associated with HBM in 11 adults from seven families. Individuals with LRP5 HBM (∼prevalence 5/100,000) displayed a variable phenotype of skeletal dysplasia with increased trabecular BMD and cortical thickness on HRpQCT, and gynoid fat mass accumulation on DXA, compared with both non-LRP5 HBM and controls. One mostly asymptomatic woman carried a novel heterozygous nonsense SOST mutation (c.530C>A; p.Ser177X) predicted to prematurely truncate sclerostin. Protein modeling suggests the severity of the LRP5-HBM phenotype corresponds to the degree of protein disruption and the consequent effect on SOST-LRP5 binding. We predict p.Asn198Ser and p.Ala242Thr directly disrupt SOST binding; both correspond to severe HBM phenotypes (BMD Z-scores +3.1 to +12.2, inability to float). Less disruptive structural alterations predicted from p.Arg266Cys, p.Thr173Met, and p.Gln89Arg were associated with less severe phenotypes (Z-scores +2.4 to +6.2, ability to float). In conclusion, although mutations in known HBM loci may be asymptomatic, they only account for a very small proportion (∼3%) of HBM individuals, suggesting the great majority are explained by either unknown monogenic causes or polygenic inheritance.
BACKGROUND: Patients with severe chronic rhinosinusitis with nasal polyps (CRSwNP) often require repeat sinus surgery. Mepolizumab reduced the need for sinus surgery in the SYNAPSE trial; this analysis sought to provide a more in-depth assessment of surgery endpoints in SYNAPSE. METHODS: SYNAPSE was a double-blind Phase III trial (NCT03085797) in adults with recurrent, refractory, severe, CRSwNP eligible for repeat sinus surgery despite standard of care treatments and previous surgery. Patients were randomized (1:1) to mepolizumab 100 mg subcutaneously or placebo, plus standard of care, every 4 weeks for 52 weeks. Time to first inclusion on a waiting list for sinus surgery and time to first actual sinus surgery (both up to week 52) were assessed; the latter endpoint was also analyzed post hoc according to time since last sinus surgery before study screening and baseline blood eosinophil count. RESULTS: Among 407 patients (mepolizumab: 206; placebo: 201), mepolizumab versus placebo reduced the risk of being included on a waiting list for sinus surgery (week 52 Kaplan-Meier probability estimate [95% confidence interval]: 13.9% [9.8%, 19.5%] vs. 28.5% [22.7%, 35.4%]). Mepolizumab versus placebo reduced the risk of sinus surgery irrespective of time (<3 vs ≥3 years) since patients' last sinus surgery prior to study screening (hazard ratios [95% confidence intervals] 0.28 [0.09, 0.84] and 0.50 [0.26, 0.98], respectively) and baseline blood eosinophil count. CONCLUSIONS: Mepolizumab reduced the risk of further sinus surgery in patients with recurrent, refractory, severe CRSwNP, irrespective of the patient baseline characteristics assessed.
Multifocal multicentric breast cancer has traditionally been considered a contraindication to breast conserving surgery because of concerns regarding locoregional control and risk of disease recurrence. However, the evidence supporting this practice is limited. Increasingly, many breast surgeons are advocating breast conservation in selected cases. This short narrative review summarises current evidence on the role of surgery in multifocal multicentric breast cancer and shows that when technically feasible the option of breast conservation is oncologically safe.